Abstract
Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.
| Original language | English |
|---|---|
| Pages (from-to) | 1136-1158 |
| Number of pages | 23 |
| Journal | Molecular Therapy |
| Volume | 31 |
| Issue number | 4 |
| DOIs | |
| State | Published - Apr 5 2023 |
UN SDGs
This output contributes to the following UN Sustainable Development Goals (SDGs)
-
SDG 3 Good Health and Well-being
Keywords
- SARS-CoV-2
- antibody
- cis-regulation
- mRNA
- oligonucleotide motif
- protein expression
- protein secretion
- vaccine
- SARS-CoV-2/genetics
- Signal Transduction
- Humans
- RNA, Messenger/genetics
- COVID-19
- Viral Vaccines
Fingerprint
Dive into the research topics of 'Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization'. Together they form a unique fingerprint.Cite this
- APA
- Author
- BIBTEX
- Harvard
- Standard
- RIS
- Vancouver